View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_47 (Length: 304)
Name: NF5689_low_47
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 85 - 202
Target Start/End: Original strand, 43560113 - 43560229
Alignment:
| Q |
85 |
tataccaaaatgattctacaaaattatttctcttttttctattgacgacacannnnnnnctatagtttcttctacaaagataatcctaatcaaaataact |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
43560113 |
tataccaaaatgattctacaaaattatttctcttttt-ctattgaggacacatttttttctatagtttcttccacaaagataatcctattcaaaataact |
43560211 |
T |
|
| Q |
185 |
tagatataaacgtaaata |
202 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43560212 |
tagatataaacgtaaata |
43560229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 200 - 263
Target Start/End: Original strand, 43560264 - 43560327
Alignment:
| Q |
200 |
atatcataagagtttgggtgtttggcgtccttcacaaaattcaatctcattaatgattgatcgt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560264 |
atatcataagagtttgggtgtttggcgtccttcacaaaattcaatctcattaatgattgatcgt |
43560327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University