View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_5 (Length: 559)
Name: NF5689_low_5
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 507 - 551
Target Start/End: Complemental strand, 7917223 - 7917179
Alignment:
| Q |
507 |
atacataatttgcatatcctcaatttttaaccttgcacctttgct |
551 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7917223 |
atacataatttgaatatcctcaatttttaaccttgcacctttgct |
7917179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University