View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_53 (Length: 253)
Name: NF5689_low_53
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 49596229 - 49595997
Alignment:
| Q |
1 |
cagcattgatcacgctttgagggtgagttatataaggaagttgaagtaccgctgatggtgattattaagttgattacaacaccaattatcaaattccc-c |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49596229 |
cagcattgatcacgctttgagggtgagttatataaggaagttgaagtaccgctgatggtgattattaagttgattacaacaccaattatcaaattccctc |
49596130 |
T |
 |
| Q |
100 |
aaaaaagagtccgctataatgtcaaacaccaaatgttctcgtatttatttttaagctttacgcaatgttgcaaattggcaaaagatgtttccatgcaaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49596129 |
aaaaaagagtccgctataatgtcaaacaccaaatgttctcgtatttatttttaagctttacgcaatgttgcaaattggcaaaagatgtttccatgcaaaa |
49596030 |
T |
 |
| Q |
200 |
ggctggctgtgtcggcggaattctcatcgttgcttgt |
236 |
Q |
| |
|
| |||||||| |||| |||||||||||||||||| |
|
|
| T |
49596029 |
g----gctgtgtccgcggtattctcatcgttgcttgt |
49595997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University