View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_66 (Length: 238)
Name: NF5689_low_66
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8624828 - 8625041
Alignment:
| Q |
1 |
ttaatggtgagatttatttatccaatcgtgaaaactagatgcacgacttgtctcacttgtgcacctagaatcgacctataccttacaatctatttctcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8624828 |
ttaatggtgagatttatttatccaatcata-----tagatgcaagacttgtctcacttgtgcacctagaatcgaccta--ccttacaatctatttctcaa |
8624920 |
T |
 |
| Q |
101 |
taatgcaaggttgttggggtatgaactgatgagttcttttgtcctgaattatctatttaacataagaaaattaaagaatatatattttatacattgacat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8624921 |
taacgcaaggttgttggggtatgaactgatgagttcttttgtcctgaattatctatttaacataagaaaattaaagaatatatattttatacatcgacat |
8625020 |
T |
 |
| Q |
201 |
tgaaaaactttatactgaatt |
221 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
8625021 |
tgaaaaactttttactgaatt |
8625041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University