View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_67 (Length: 237)
Name: NF5689_low_67
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 17 - 156
Target Start/End: Original strand, 11263128 - 11263267
Alignment:
| Q |
17 |
gctagactgcttaacaaatgaatcatttttaaaacagttgttcgtagtgtgaaagatgcgaagaaactgcgggttaattacttgctgttgttctgcagaa |
116 |
Q |
| |
|
|||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
11263128 |
gctagactacttgacaaatgaatcatgattaaaacagttgttcgtagtgtgaaagatgcgaagaaattgcgggttaattacttgctgttcttctgtagaa |
11263227 |
T |
|
| Q |
117 |
aaagcttgcaatcatggcaaaacataaacatgtggcataa |
156 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11263228 |
aaagcgtgcaatcatggcaaaacataaacatgtggcataa |
11263267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 11263267 - 11263316
Alignment:
| Q |
174 |
agtagtagctaaaactggaaaataaatcttaagcattttattgatgttgt |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
11263267 |
agtagtagctaaaactggtcaataaatctttagcattttattgatgttgt |
11263316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University