View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5689_low_67 (Length: 237)

Name: NF5689_low_67
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5689_low_67
NF5689_low_67
[»] chr2 (2 HSPs)
chr2 (17-156)||(11263128-11263267)
chr2 (174-223)||(11263267-11263316)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 17 - 156
Target Start/End: Original strand, 11263128 - 11263267
Alignment:
17 gctagactgcttaacaaatgaatcatttttaaaacagttgttcgtagtgtgaaagatgcgaagaaactgcgggttaattacttgctgttgttctgcagaa 116  Q
    |||||||| ||| |||||||||||||  |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||    
11263128 gctagactacttgacaaatgaatcatgattaaaacagttgttcgtagtgtgaaagatgcgaagaaattgcgggttaattacttgctgttcttctgtagaa 11263227  T
117 aaagcttgcaatcatggcaaaacataaacatgtggcataa 156  Q
    ||||| ||||||||||||||||||||||||||||||||||    
11263228 aaagcgtgcaatcatggcaaaacataaacatgtggcataa 11263267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 11263267 - 11263316
Alignment:
174 agtagtagctaaaactggaaaataaatcttaagcattttattgatgttgt 223  Q
    ||||||||||||||||||  |||||||||| |||||||||||||||||||    
11263267 agtagtagctaaaactggtcaataaatctttagcattttattgatgttgt 11263316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University