View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_68 (Length: 237)
Name: NF5689_low_68
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 33102441 - 33102256
Alignment:
| Q |
1 |
tataattgttttaagtgatgttatgttcatctttgtttgagtaacataaaatttatgcaaccttgttaagtgtgtgaatttcttacattgaactgagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
33102441 |
tataattgttttaagtgatgttatgtctatctttgtttgagtaacataaaatttatgcaaccttgttaagtgagtgaatttcttgcatggaactgagttt |
33102342 |
T |
 |
| Q |
101 |
gtgtcttgaaattcatttggtgcaactaagttgaaaaatagagatcatgatagaactaaatttatttttgtgggaagtttatatgacc |
188 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102341 |
gtgacttgaaagtcatttggtgcaactaagttgaaaaat--agatcataatataactaaatttatttttgtgggaagtttatatgacc |
33102256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University