View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_8 (Length: 508)
Name: NF5689_low_8
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 11334508 - 11334280
Alignment:
| Q |
8 |
acatcatcatctcttaggtcagtgtcctctctcaacaaaagtcacaccctttttgttcacttttctctccccactccattattctactctcttccatttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11334508 |
acatcatcatctcttaggtcagtgtcctctctcaacaaaagtcacaccctttttgctcacttttctctccccactccattattatactctcttccatttt |
11334409 |
T |
 |
| Q |
108 |
ctcatcataaaagctaatttggtaactgtgcttgaaacttgaaagaaactagttttgtagttttgttaggtaacagtgtgtgtatgtgtaagtgagtgat |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11334408 |
ctcatcataaaagctagtttggtaactgtgcttgaaacttgaaagaaactagttttgtagttttgttagctaacagtgtgtgtatgtgtaagtgagtgat |
11334309 |
T |
 |
| Q |
208 |
gtgcaacaagaacagtagtactctttcac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11334308 |
gtgcaacaagaacagtagtactctttcac |
11334280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 304 - 363
Target Start/End: Complemental strand, 11334212 - 11334153
Alignment:
| Q |
304 |
tatatgttcatcaatttcaccttcttcatcttcctcttcttcttcactaaaatcacgtag |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11334212 |
tatatgttcatcaatttcaccttcttcatcttcctcttcctcttcactaaaatcacgtag |
11334153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University