View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_84 (Length: 203)
Name: NF5689_low_84
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_84 |
 |  |
|
| [»] scaffold0290 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0290 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: scaffold0290
Description:
Target: scaffold0290; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 6105 - 5942
Alignment:
| Q |
20 |
atgcaaacccagttcaaattcaaactcacagctctcttcctctgtttctttttaactttctccctctccgacgccgacaacaaaatgggaactgtcgatc |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6105 |
atgcaaacccagctcaaattcaaactcacagctctcttcctttgtttctttttaactttctccctctccgacgctgacaacaaaatgggaactgtcgatc |
6006 |
T |
 |
| Q |
120 |
gagcgtctgctacggaaactttccatccaatactctagtagatttcatcaatgccgatagcttaact |
186 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6005 |
gagcgtctgctacggaaactttcca---attactctagtagatttcatcaataccgatagcttaact |
5942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University