View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5689_low_84 (Length: 203)

Name: NF5689_low_84
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5689_low_84
NF5689_low_84
[»] scaffold0290 (1 HSPs)
scaffold0290 (20-186)||(5942-6105)


Alignment Details
Target: scaffold0290 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: scaffold0290
Description:

Target: scaffold0290; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 6105 - 5942
Alignment:
20 atgcaaacccagttcaaattcaaactcacagctctcttcctctgtttctttttaactttctccctctccgacgccgacaacaaaatgggaactgtcgatc 119  Q
    |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
6105 atgcaaacccagctcaaattcaaactcacagctctcttcctttgtttctttttaactttctccctctccgacgctgacaacaaaatgggaactgtcgatc 6006  T
120 gagcgtctgctacggaaactttccatccaatactctagtagatttcatcaatgccgatagcttaact 186  Q
    |||||||||||||||||||||||||   | |||||||||||||||||||||| ||||||||||||||    
6005 gagcgtctgctacggaaactttcca---attactctagtagatttcatcaataccgatagcttaact 5942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University