View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690-Insertion-7 (Length: 140)
Name: NF5690-Insertion-7
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690-Insertion-7 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 5e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 44125924 - 44125790
Alignment:
| Q |
8 |
cgctgcttaatttcctctcatggagcgaatagtagttaactactgttgcggtattttggtcatttccatg--tgtgatggcaaatcatttagtgtaaaca |
105 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44125924 |
cgctgcttaattttctctcatggagcgaatagtagttaactaccgttgcggtattttggtcatttccatgtgtgtgatggcaaatcatttagtgtaaacg |
44125825 |
T |
|
| Q |
106 |
gcagttttcatttagggatgaaggagagagaagct |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44125824 |
gcagttttcatttagggatgaaggagagagaagct |
44125790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 114
Target Start/End: Complemental strand, 48855691 - 48855615
Alignment:
| Q |
40 |
tagttaactactgttgcggtattttggtcatttccatgt--gtgatggcaaatcatttagtgtaaacagcagttttc |
114 |
Q |
| |
|
||||||| ||| ||| |||||||||||||||| ||||| ||||| ||||||||||||||| ||||| || ||||| |
|
|
| T |
48855691 |
tagttaagtaccgtttaggtattttggtcattttcatgtatgtgatagcaaatcatttagtgcaaacaacatttttc |
48855615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 58 - 113
Target Start/End: Original strand, 6152476 - 6152533
Alignment:
| Q |
58 |
gtattttggtcatttccatgtgtg--atggcaaatcatttagtgtaaacagcagtttt |
113 |
Q |
| |
|
||||||||| |||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
6152476 |
gtattttggacatttccatgtgtgtgattgcaaataatttagtgtaaacagcaatttt |
6152533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University