View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_high_12 (Length: 328)
Name: NF5690_high_12
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 7239188 - 7239324
Alignment:
| Q |
1 |
ccaccacttcaactggtttcctggtagtattatttatta-tttaaatggagacaaacctcggaatgtgttttagaactttaaagaatgatccgaaa---- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7239188 |
ccaccacttcaactggtttcctggtagtattatttattaatttaaatggagacaaatttcggaatgtgttttagaactttaaagaatgatccgaaaacaa |
7239287 |
T |
 |
| Q |
96 |
-acttttaaaaaatgtgttctagacatgtaacaagac |
131 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7239288 |
gacttttaaagaatgtgttctagacatgtaacaagac |
7239324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University