View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_high_13 (Length: 315)
Name: NF5690_high_13
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_high_13 |
 | |
|
| [»] scaffold0028 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 22078290 - 22077997
Alignment:
| Q |
1 |
gcaactaaatttttcctatgggatcgtgagtgcaatgaattgcttggaactacagctgctgatctttattaaagggtcatggctgaggtattcatatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||| |
|
|
| T |
22078290 |
gcaactaaatttttcctatgggatcgtgagtgcaatgaattgcttggaactacagctgctgatcttca---aagggtcatggctgaggtattgatatgca |
22078194 |
T |
|
| Q |
101 |
catttgtacaatatatcttttgaaaacatgaatactgattgtatgttatgtatataatgattataggctggtgtcacaaatcctctggaatacccaacac |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22078193 |
catctgtacaatatatcttttgaaaacatgaatactgattgtatgttatgtatatattgattataggctggtgtcacaaatcctctggaata-ccaacac |
22078095 |
T |
|
| Q |
201 |
acctggaccaattggaaaatagagagtttatttgtaaagttaagtggcagccaacttgggacagctgttcggtgcaagcaatcaaggaggatgaaggt |
298 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
22078094 |
acttggaccaattggaaaacagagagtttatttgtaaagttaaatggcagccaacttgggacagctgttcggttcaagcaatcaaggaagatgaaggt |
22077997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 164 - 298
Target Start/End: Complemental strand, 123355 - 123221
Alignment:
| Q |
164 |
taggctggtgtcacaaatcctctggaatacccaacacacctggaccaattggaaaatagagagtttatttgtaaagttaagtggcagccaacttgggaca |
263 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| || ||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
123355 |
taggctggtgtcacaaatcctttggaatatccaattcatctggaccaattggaaaatagaaagttggtttgtaaagttaagtggcagccatcttgggaca |
123256 |
T |
|
| Q |
264 |
gctgttcggtgcaagcaatcaaggaggatgaaggt |
298 |
Q |
| |
|
| ||||| || |||||| ||||||| ||||||||| |
|
|
| T |
123255 |
gttgttcagttcaagcagtcaaggaagatgaaggt |
123221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 123510 - 123446
Alignment:
| Q |
1 |
gcaactaaatttttcctatgggatcgtgagtgcaatgaattgcttggaactacagctgctgatct |
65 |
Q |
| |
|
|||||||| |||||| | |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
123510 |
gcaactaagtttttcttctgggatcgtgagtgcaatcaattgcttggaactacagctgctgatct |
123446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 9e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 164 - 298
Target Start/End: Complemental strand, 23697136 - 23697002
Alignment:
| Q |
164 |
taggctggtgtcacaaatcctctggaatacccaacacacctggaccaattggaaaatagagagtttatttgtaaagttaagtggcagccaacttgggaca |
263 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| || |||||| |||||||||| ||| | | | |||||||| |||||||||||||||||||||| |
|
|
| T |
23697136 |
taggctggtgtcacaaatccattggaatatccaatactactggactaattggaaaaaagaaatgtcgtctgtaaagtgaagtggcagccaacttgggaca |
23697037 |
T |
|
| Q |
264 |
gctgttcggtgcaagcaatcaaggaggatgaaggt |
298 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
23697036 |
gttgttcagtgcaagcaatcaaggaggatgaaggt |
23697002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 23697276 - 23697229
Alignment:
| Q |
19 |
tgggatcgtgagtgcaatgaattgcttggaactacagctgctgatctt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23697276 |
tgggatcgtgagtgcaatgaattgcttggaactacagctgcggatctt |
23697229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University