View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_high_16 (Length: 256)
Name: NF5690_high_16
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 136 - 242
Target Start/End: Complemental strand, 39504203 - 39504097
Alignment:
| Q |
136 |
ttattagacttgccagctcaagaacatgatattgtgcttttatgtgatctggaagccattgatcgagaacagccgtactctttttggttgtcgtcactat |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
39504203 |
ttattagacttgccatttcaagaacatgatactgcacttttatgtgatctggaagccattgatcgagaacagccgcaccctttttggttgcagtcactat |
39504104 |
T |
 |
| Q |
236 |
cttttct |
242 |
Q |
| |
|
||||||| |
|
|
| T |
39504103 |
cttttct |
39504097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University