View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_high_19 (Length: 250)
Name: NF5690_high_19
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 33485775 - 33485532
Alignment:
| Q |
1 |
aatatgatcatgttttccacaaaagctacaccattttgcattctaattccctttccctctagcaagaagtttcttgctctcaagaagattaat--gagaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
33485775 |
aatatgatcatgttttccacaaaagctacaccattttgcattctaattccctttctctctagcaagaggtttcttgctctcaacaagattaatgagagaa |
33485676 |
T |
 |
| Q |
99 |
gaggactcctcttgaacatgaattaaacaattttttctctcgtgttctatcaacacagnnnnnnngagtggtaataggaggtgaatgattaatcaagtga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33485675 |
gaggactcctcttgaacatgaattaaacaattttttctctcgtgttctatcaacacagaaaaaaagagtggtaataggaggtgaatgattaatcaagtga |
33485576 |
T |
 |
| Q |
199 |
atttgatattttatcattgcaaaattgtcattttgacctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33485575 |
atttgatattttatcattgcaaaattgtcattttgacctttgct |
33485532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University