View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_high_22 (Length: 245)
Name: NF5690_high_22
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 6158020 - 6157797
Alignment:
| Q |
1 |
tcggtgtagtgataatannnnnnncactacaattctcgagacaaagagnnnnnnnnnttgtgtgttcactctcatcttctctctgtgtagttggttgtga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6158020 |
tcggtgtagtgataatatttttttcactacaattctcgagacaaagagaaaaaaa--ttgtgtgttcactctcatcttctctctgtgtagttggttgtga |
6157923 |
T |
 |
| Q |
101 |
ttgtaggagatatgagttgtttttctggctttgtttgttgttggaaaaagaatggaggaacaaacacatcaggtaccgataaataatggttttcaaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6157922 |
ttgtaggagatatgagttgtttttctggctttgtttattgttggaaaaagaatggaggaacaaacacatcaggtaccgataaataatggttttcaaattc |
6157823 |
T |
 |
| Q |
201 |
aagtaaatcaattattattattatac |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6157822 |
aagtaaatcaattattattattatac |
6157797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University