View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_high_23 (Length: 240)
Name: NF5690_high_23
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 53676701 - 53676480
Alignment:
| Q |
1 |
ttttcaatgctgaaaattttactatctgttatgtgtgcagttgatgtagataattcattacttttgggaaaaggaacaatagaaggaaaatttgattgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676701 |
ttttcaatgctgaaaattttactatctgttatgtgtgcagttgatgtagataattcattacttttgggaaaaggaacaatagaaggaaaatttgattgtg |
53676602 |
T |
|
| Q |
101 |
gttatttagtgtcagtggaattgggttcagaagttctcaaaggggtgctttaccatccagaaaaagtggtttctccttcatcattggttacacaacacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676601 |
gttatttagtgtcagtggaattgggttcagaagttctcaaaggggtgctttaccatcaagaaaaagtggtttctccttcatcattggttacacaacacaa |
53676502 |
T |
|
| Q |
201 |
cggtgccattgagccattcaat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53676501 |
cggtgccattgagccattcaat |
53676480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 197
Target Start/End: Complemental strand, 19108499 - 19108410
Alignment:
| Q |
109 |
gtgtcagtggaattgggttcagaagttctcaaagggg-tgctttaccatccagaaaaagtggtttctccttcatcattggttacacaaca |
197 |
Q |
| |
|
||||||||| |||| ||||||| ||| || |||||| || ||||||||||||||||| ||||| | ||| ||||||||||| ||||||| |
|
|
| T |
19108499 |
gtgtcagtgaaatttggttcagtggttttcgaagggggtggtttaccatccagaaaaattggttgcacctccatcattggttccacaaca |
19108410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University