View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_10 (Length: 389)
Name: NF5690_low_10
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 3e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 21546446 - 21546596
Alignment:
| Q |
35 |
agaatgccataaacataaaatcatgtgtaacttccaaattaatgtatgggaaattaatgggagata-ttttttggtagctgataagagcgattgaaggtg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| |||||||| |||||| |
|
|
| T |
21546446 |
agaatgccataaacataaaatcatgtgtaacttccaaattaatgtatgggaaatgaatgggagatatttttttggcagctgataggagcgattaaaggtg |
21546545 |
T |
 |
| Q |
134 |
ggtttgctgtgcaatgctttactgtcaaatattcattagaaattataaaat |
184 |
Q |
| |
|
| |||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21546546 |
gatttgatgtgcaacgctttactgtcaaatattcattagaaattataaaat |
21546596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 247 - 375
Target Start/End: Complemental strand, 46424267 - 46424140
Alignment:
| Q |
247 |
attaaaagcaattactgggcggaaaacacttgcgtgctttgtgttattattatttacttgtttatgaaccctattgttgctcttttaagatgaagcggtg |
346 |
Q |
| |
|
|||||||| ||||||||| |||||| || || |||||||||| |||| ||||||||||||||| |||| | |||||||||||||||||||||||| || |
|
|
| T |
46424267 |
attaaaag-aattactggccggaaatcatgtgtgtgctttgtgctattgttatttacttgtttaaaaaccatgttgttgctcttttaagatgaagcgatg |
46424169 |
T |
 |
| Q |
347 |
aattcattaaatataagatccaatggatg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46424168 |
aattcattaaatataagatccaatggatg |
46424140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 297 - 375
Target Start/End: Complemental strand, 9453031 - 9452953
Alignment:
| Q |
297 |
tatttacttgtttatgaaccctattgttgctcttttaagatgaagcggtgaattcattaaatataagatccaatggatg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
9453031 |
tatttacttgtttatgaaccctattgttgctcttttaagatgaagcggtaaattcattaaatataagatctaatggatg |
9452953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University