View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5690_low_17 (Length: 256)

Name: NF5690_low_17
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5690_low_17
NF5690_low_17
[»] chr1 (1 HSPs)
chr1 (136-242)||(39504097-39504203)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 136 - 242
Target Start/End: Complemental strand, 39504203 - 39504097
Alignment:
136 ttattagacttgccagctcaagaacatgatattgtgcttttatgtgatctggaagccattgatcgagaacagccgtactctttttggttgtcgtcactat 235  Q
    |||||||||||||||  |||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||| || |||||||||||  ||||||||    
39504203 ttattagacttgccatttcaagaacatgatactgcacttttatgtgatctggaagccattgatcgagaacagccgcaccctttttggttgcagtcactat 39504104  T
236 cttttct 242  Q
    |||||||    
39504103 cttttct 39504097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University