View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_18 (Length: 254)
Name: NF5690_low_18
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 235
Target Start/End: Original strand, 7238617 - 7238838
Alignment:
| Q |
14 |
ttctccaaaatcttccaatctttcaggaaataggttcattgtaaacccgaataattacgattagaactgaaacaaaaccatgctttgttcataatgttac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7238617 |
ttctccaaaatcttccaatctttcaggaaataggttcattgtaaacccgaataattacgattagaactgaaacaaaaccatgctttgttcatgatgttac |
7238716 |
T |
 |
| Q |
114 |
cttcttcgagaatatactgtcacgaataaagaaatggtgtggagtgtcactgacagtgccaaattgctttaaacttacaaatttgctcataatttcgtct |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7238717 |
cttcttcgacaatatactgtcacgaataaagaaatggtgtggagtgtcactgacagtgccaaattgctttaaacttacaaatttgctcataatttcgtct |
7238816 |
T |
 |
| Q |
214 |
ttgaaatttgtatggtatgaac |
235 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
7238817 |
ttgaaatttatatggtatgaac |
7238838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 202
Target Start/End: Complemental strand, 41425855 - 41425791
Alignment:
| Q |
138 |
aataaagaaatggtgtggagtgtcactgacagtgccaaattgctttaaacttacaaatttgctca |
202 |
Q |
| |
|
||||||| |||||| || ||||||||||| |||| |||||||||| |||||| ||| ||| |||| |
|
|
| T |
41425855 |
aataaagtaatggtctgaagtgtcactgatagtgtcaaattgcttaaaacttccaagttttctca |
41425791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 136 - 229
Target Start/End: Original strand, 5839798 - 5839891
Alignment:
| Q |
136 |
cgaataaagaaatggtgtggagtgtcactgacagtgccaaattgctttaaacttacaaatttgctcataatttcgtctttgaaatttgtatggt |
229 |
Q |
| |
|
|||| |||| |||||||| |||||||||| || | | |||| ||| |||||| ||||||| |||| |||||| ||||||||||||| ||||| |
|
|
| T |
5839798 |
cgaacaaagtaatggtgtttagtgtcactggcaatatcgaatttcttaaaacttccaaatttcctcagaatttcatctttgaaatttgcatggt |
5839891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University