View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_19 (Length: 253)
Name: NF5690_low_19
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_19 |
 | |
|
| [»] scaffold0054 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 32958389 - 32958602
Alignment:
| Q |
18 |
ttaatgaagtatatgttttcaaataaaattaagaaccatgatttgaaaacgaattcaaaacgcatgaaagatttaagatgaagatcagagaaggcaatat |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958389 |
ttaatgaagtatatgttttcgaataaaattaagaaccatgatttgcaaacgaattcaaaacgcatgaaagatttaagatgaagatcagagaaggcaatat |
32958488 |
T |
|
| Q |
118 |
catcatatttatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatacggat |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958489 |
catcatatatatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatacggat |
32958588 |
T |
|
| Q |
218 |
ggtacgagtaagga |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32958589 |
ggtacgagtaagga |
32958602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 54 - 213
Target Start/End: Complemental strand, 38630 - 38473
Alignment:
| Q |
54 |
catgatttgaaaacgaattcaaaacgcatgaaagatttaagatgaagatcagagaaggcaatatcatcatatttatatagttgttgttcgccttttcttt |
153 |
Q |
| |
|
||||||||| ||| | ||||||||||| |||||||||||||||| |||| ||||||||||||||||||| | |||| | |||||||| |||||| || |
|
|
| T |
38630 |
catgatttgcaaatggattcaaaacgcttgaaagatttaagatgcagattggagaaggcaatatcatcatgtctata--gctgttgttcacctttttgtt |
38533 |
T |
|
| Q |
154 |
tgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532 |
tgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatac |
38473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University