View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_23 (Length: 248)
Name: NF5690_low_23
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 91 - 234
Target Start/End: Complemental strand, 53285592 - 53285449
Alignment:
| Q |
91 |
ataccttcactaaaaattttagtatcacattccatccaaagaaaagagtataacatcgcataagaacgggtcattgtgttttgatacaaaaaggtaaaag |
190 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53285592 |
ataccttcactaaaaaatttagtatcacattcgatccaaagaaaagagtataacatcgcataagaacgggtcattgtgttttgatacaaaaaggtaaaag |
53285493 |
T |
 |
| Q |
191 |
aattaggcttcgaagactaaatatttactgagttatctacaaat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
53285492 |
aattaggcttcgaagactaaatatttactgcgttatgtacaaat |
53285449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 53288766 - 53288676
Alignment:
| Q |
1 |
agtattatatttaagaaggaaggtagtagtagtaaaattatgtgcctgttttctacacaaagtattcttataaaggataatattatagaaa |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53288766 |
agtattatatttaagaaggaaggtagtagtagtaaaattatgtgcctgttttctacacaaagtattcttataaaggataatattatagaaa |
53288676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University