View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_26 (Length: 239)
Name: NF5690_low_26
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_26 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 125 - 239
Target Start/End: Complemental strand, 41072395 - 41072281
Alignment:
| Q |
125 |
ctgtttgataccatatacttcctcagtttcgcaatattacgatttctcaaatccacttttgaaggaaacatggagatgaggacgccgtgatactcaattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41072395 |
ctgtttgataccatatacttcctcagtttcgcaatattacgatttctcaaatccacttttgaaggaaacatggagatgaggacgccatgatactcaattt |
41072296 |
T |
|
| Q |
225 |
tgatgaaagcgctct |
239 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41072295 |
tgatgaaagcgctct |
41072281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 41072517 - 41072420
Alignment:
| Q |
17 |
caggtcctcttctcaacacggatgtatagatctaaaataattattaaatttgttggatctaaatgcttgcttccaaacaataccctatttgttggtgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41072517 |
caggtcctcttctcaacacggatgtatagatctaaaataattattaaatttgttggatctaaatgcttgcttccaaacaataccctatttgttggtgt |
41072420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University