View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_27 (Length: 237)
Name: NF5690_low_27
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 222
Target Start/End: Complemental strand, 36690010 - 36689830
Alignment:
| Q |
39 |
catagtaagctaaagatatctttccaatcttgcaannnnnnnnnngtgtgcacttcaagcactttagttcccttgaattaagaccaatttttcaaaatgg |
138 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36690010 |
catagtaagctaaagatacctttccaatcttgcaatttttttt---tgtgcacttcaagcactttagttcccttgaattaagaccaatttttcaaaatgg |
36689914 |
T |
 |
| Q |
139 |
tgtcaccaaatgttgaatccactacagcagactccacacatacctttcgaaacttggttaagaaatcatgggctaagttagtga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36689913 |
tgtcaccaaatgttgaatccactacagcagactccacatatacctttcgaaacttggttaagaaatcatgggctaagttagtga |
36689830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 36690069 - 36690023
Alignment:
| Q |
6 |
tgtgtccttagctcaagacaatatcactaagttcatagtaagctaaa |
52 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36690069 |
tgtgtccttagctcatgacaatatcactaagttcatagtaagctaaa |
36690023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University