View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5690_low_29 (Length: 221)
Name: NF5690_low_29
Description: NF5690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5690_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 12829012 - 12828830
Alignment:
| Q |
18 |
atatctccggtggaactggcgatgggagaagggaatgaggatgatgaataaacccttcgtttttgctatctacacctccttgttcataactaatttcgtt |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12829012 |
atatctccggtggaactggcgttgggagaagagaatgaggatgatgaataaacccttcgtttttgctatctacacctccttgttcataactaatttcgtt |
12828913 |
T |
 |
| Q |
118 |
gttagtaacggtttcgtggccgttagcgtgattttcgggtaagacgaaatgaagtggattatttatgggttgaagttgaactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12828912 |
gttagtaacggtttcgtggccgttagcgtgattttcgggtaagacgaaatgaagtggaatatttatgggttgaagttgaactg |
12828830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University