View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5691-Insertion-4 (Length: 130)

Name: NF5691-Insertion-4
Description: NF5691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5691-Insertion-4
NF5691-Insertion-4
[»] chr8 (2 HSPs)
chr8 (51-129)||(7314146-7314224)
chr8 (8-35)||(7314257-7314284)


Alignment Details
Target: chr8 (Bit Score: 75; Significance: 6e-35; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 7314224 - 7314146
Alignment:
51 aacccatccaccattaaaacccatcgatctgcatcactaatcacaaaatcgttgatctttctccgcgaatatgtcatcc 129  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7314224 aacccatccaccgttaaaacccatcgatctgcatcactaatcacaaaatcgttgatctttctccgcgaatatgtcatcc 7314146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 35
Target Start/End: Complemental strand, 7314284 - 7314257
Alignment:
8 aacccatcttaccgcatggaaccctatc 35  Q
    ||||||||||||||||||||||||||||    
7314284 aacccatcttaccgcatggaaccctatc 7314257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University