View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5691-Insertion-4 (Length: 130)
Name: NF5691-Insertion-4
Description: NF5691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5691-Insertion-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 6e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 7314224 - 7314146
Alignment:
| Q |
51 |
aacccatccaccattaaaacccatcgatctgcatcactaatcacaaaatcgttgatctttctccgcgaatatgtcatcc |
129 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7314224 |
aacccatccaccgttaaaacccatcgatctgcatcactaatcacaaaatcgttgatctttctccgcgaatatgtcatcc |
7314146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 35
Target Start/End: Complemental strand, 7314284 - 7314257
Alignment:
| Q |
8 |
aacccatcttaccgcatggaaccctatc |
35 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7314284 |
aacccatcttaccgcatggaaccctatc |
7314257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University