View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5691_high_5 (Length: 356)
Name: NF5691_high_5
Description: NF5691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5691_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 91 - 342
Target Start/End: Original strand, 1112882 - 1113133
Alignment:
| Q |
91 |
gttaagtttatttagtgaccacattatcccttgcagctgcatgtgttactggcagaacagatgttcaatgtctgcatcgttggcaaaaggttttgaatcc |
190 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1112882 |
gttaagtttatttagtgaccacataatcccttgcagctgcatgtgttactggcagaacagatgttcaatgtctgcatcgttggcaaaaggttttgaatcc |
1112981 |
T |
 |
| Q |
191 |
tgatcttatcaaaggaccttggtcagaacaggtaaaaattaagttatatcactgaatttagagattatgctattttaattaaccagtgaatttggagatt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1112982 |
tgatcttatcaaaggaccttggtcagaacaggtaaaaattaagttatatcactgaatttagagattatgctattttaattaaccagtgaatttggagatt |
1113081 |
T |
 |
| Q |
291 |
atgttcttttaattaaccgctgaatttggagtttgcaggaagataatcaact |
342 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1113082 |
atgctcttttaattaaccactgaatttggagtttgcaggaagataatcaact |
1113133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 1112792 - 1112847
Alignment:
| Q |
1 |
agttaccgatctgtttactgcgcgaacgtgtgaattgtcactgcagcaaaattgggagac |
60 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
1112792 |
agttaccaatctgtttactgcgcgaacatgtgaatt----ttgcagcaaaattgggagac |
1112847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University