View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5691_low_11 (Length: 228)
Name: NF5691_low_11
Description: NF5691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5691_low_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 34372181 - 34371960
Alignment:
| Q |
7 |
tataaattatgtatgttatgaatatgataatgagctaggcgctttgtggtgtccatgagttaggcactttattatctagttgtatgtaacttattcattc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34372181 |
tataaattatgtatgttatgaatatgataatgagctaggcgctttgtggtgtccatgagttaggcactttattatctagttgtatgtaacttattcattt |
34372082 |
T |
 |
| Q |
107 |
gatctatgagaagttgataactctaaatgatttaacaagtatccagcaaagaataaagaggaatattaaagatactctctttataacacattttttagag |
206 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
34372081 |
gatttatgagaagttgataactctaaatgattagacaagtatccagtaaagaatagagaggaatgttaaagatattctctttataacactttttttagag |
34371982 |
T |
 |
| Q |
207 |
aattgttgtttacacatttgat |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34371981 |
aattgttgtttacacatttgat |
34371960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 228
Target Start/End: Original strand, 42165094 - 42165122
Alignment:
| Q |
200 |
tttagagaattgttgtttacacatttgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42165094 |
tttagagaattgttgtttacacatttgat |
42165122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University