View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5691_low_8 (Length: 240)
Name: NF5691_low_8
Description: NF5691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5691_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 11485337 - 11485563
Alignment:
| Q |
1 |
aaaaaatactatttaaatttagaaacacttcaacaattgttgcataaagtctatattacttatttttagagggataaagtctgtattactgaaaggcctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11485337 |
aaaaaatactatttaaatttagaaacacttcaacaattgttgcataaagtctatattacttttttttagagggataaagtctgtattactgaaaggcctt |
11485436 |
T |
|
| Q |
101 |
agtaatacactagagccccataacgccaacaagtttagtgttttatcaagagctagaaaaggaaaaaagggagagtggaggagtgtgatgcgcaggaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11485437 |
agtaatacactagagccccataacgccaacaagtttagtgttttatcaagagctagaaaaggaaaaaagggagagtggaggagtgtgatgcgcaggaggg |
11485536 |
T |
|
| Q |
201 |
gcaacgaaggtagtgggggtgtggttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11485537 |
gcaacgaaggtagtgggggtgtggttg |
11485563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University