View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5695-Insertion-3 (Length: 297)
Name: NF5695-Insertion-3
Description: NF5695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5695-Insertion-3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 8 - 297
Target Start/End: Complemental strand, 10007018 - 10006712
Alignment:
| Q |
8 |
aaattttggggttttccttagtgttgctcactaaaatcagatttggaaaccatagctcatattggatccataaatcacgactttgaggtttaaatgaagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10007018 |
aaattttggggttttccttagtgttgctcactaaaatcagatttggaaaccatagctcatattggatccataaatcacgactttgaggtttaaatgaagg |
10006919 |
T |
|
| Q |
108 |
tgttaaaggatcaaatctcaaatcaaatataaacatgtcccaaacccttcatcagaagtgcatacatgggaacataaacttatatggaagaggatgaacg |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10006918 |
tgttaaaggatcaaatctcaaatctaatataaacatgtcccaaacccttcatcagaagtgcatacatgggaacataaacttatatggaagaggatgaacg |
10006819 |
T |
|
| Q |
208 |
aatatgttccgg-----------------ccacacatgttccacaaggcttctaacgctatggttccatggggtcgtggcacgaacgtgcacaggactga |
290 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10006818 |
aatatgttccggtatgggttggcgcccaaccacacatgttccacaaggcttctaacgctatgggtccatggggccgtggcacgaacgtgcacaggactga |
10006719 |
T |
|
| Q |
291 |
aggtgaa |
297 |
Q |
| |
|
||||||| |
|
|
| T |
10006718 |
aggtgaa |
10006712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University