View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5697_high_11 (Length: 204)
Name: NF5697_high_11
Description: NF5697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5697_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 78 - 190
Target Start/End: Complemental strand, 9760904 - 9760792
Alignment:
| Q |
78 |
attttagaaaataaatggcaaacatgaatgttgcatgtgtggttttggtgatatgcatgtttgtttgcacctatgcagaagctagaattgactgctatga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
9760904 |
attttagaaaataaatggcaaacatgaatgttgcatgtgtggttttggtgatatgcatgtttgtttgcacctatgcagaagctataatttactgctatga |
9760805 |
T |
|
| Q |
178 |
tacagctgatatt |
190 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9760804 |
tacagctgatatt |
9760792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University