View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5697_low_8 (Length: 244)
Name: NF5697_low_8
Description: NF5697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5697_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 25324155 - 25324374
Alignment:
| Q |
18 |
gagaattcatctcatacatctaataggttctctatcgaagattaatcacagttaaacatcaatgtatacttcagatctataacatgcttatnnnnnnn-t |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| | | |
|
|
| T |
25324155 |
gagaattcatcttatacatctaataggttctctatcgaagattaatcacagttaaacgttaatgtatacttcagatctataacatgcttgtaaaaaaaat |
25324254 |
T |
 |
| Q |
117 |
cttttgggtttatatttatattttcttgcactttaaaagcaaaaacaagaagggtacgtattaggtagaaatataaaagtgcctgcatcatttgtgataa |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25324255 |
cttttgggtttatgtttatattttcttgcactttaaaagcaaaaacaagaagggtacgtattaggtagaaatataaaagtgcctgcatcatttgtgataa |
25324354 |
T |
 |
| Q |
217 |
cttggttgaccacactgtct |
236 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
25324355 |
cttgggtgaccacactgtct |
25324374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University