View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5698-Insertion-5 (Length: 103)
Name: NF5698-Insertion-5
Description: NF5698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5698-Insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 36422795 - 36422712
Alignment:
| Q |
8 |
ggttgttgatggcgagtggagaaggatggtttgtggattggatttgaagattgaaaacggttctttgaggtgcaccatccagag |
91 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422795 |
ggttgttgacggcgagtggagaaggatggtttgtggattggatttgaagattgaaaacggttctttgaggtgcaccatccagag |
36422712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University