View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5698_high_9 (Length: 239)
Name: NF5698_high_9
Description: NF5698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5698_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 36423003 - 36422790
Alignment:
| Q |
11 |
cacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaagttctttgtctggttcttctagaacaatggaattgagagtgtaactg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423003 |
cacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaagttctttgtctggttcttctagaacaatggaattgagagtgtaactg |
36422904 |
T |
|
| Q |
111 |
tttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaattcttggatggttagagggtctaaagggtggcgaggttcatcggatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422903 |
tttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaattcttggatggttagagggtctaaagggtggcgaggttcatcggatt |
36422804 |
T |
|
| Q |
211 |
catggtttggttgt |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36422803 |
catggtttggttgt |
36422790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University