View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5699-Insertion-4 (Length: 160)
Name: NF5699-Insertion-4
Description: NF5699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5699-Insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 9e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 9e-50
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 27371231 - 27371108
Alignment:
| Q |
8 |
agagtcactgtccctacaaccttcaccgtctctaccaccttcggcagtcaccaataacacttctttaggtttgtttacggcaccatagctaccacaattg |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
27371231 |
agagtcactgtcgctacaaccttcaccgtctctaccaccttcggcagtcaccaataatacctctttaggtttgttttcggcaccatatctaccacaattg |
27371132 |
T |
|
| Q |
108 |
attgaacattttactatgtattta |
131 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
27371131 |
attcaacattttactatgtattta |
27371108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University