View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5699_low_7 (Length: 252)
Name: NF5699_low_7
Description: NF5699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5699_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 158 - 232
Target Start/End: Original strand, 32266026 - 32266100
Alignment:
| Q |
158 |
attcacagctttactgttatgagattttgcagcaggaaaagaatcactttctgaactgttttcttcatcactctc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266026 |
attcacagctttactgttatgagattttgcagcaggaaaagaatcactttctgaactgttttcttcatcactctc |
32266100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 32265888 - 32265956
Alignment:
| Q |
20 |
atgtgatcttttatgtcctcctaatgcttgtcctgacctgaaaattttataacaaattggacattcata |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32265888 |
atgtgatcttttatgtcctcctaatgcttgtcctgacctgaaaattttgtagcaaattggacattcata |
32265956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University