View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5699_low_9 (Length: 235)
Name: NF5699_low_9
Description: NF5699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5699_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 99 - 212
Target Start/End: Complemental strand, 5941311 - 5941198
Alignment:
| Q |
99 |
gcgttagcgtcggatacgtcgatcatattcagtcaccggttagttctcctatctttcttgttcacgttcattgagatatgttgagagaatgaatttggga |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5941311 |
gcgttagcatcggatacgtcgatcatattcagtcaccggttagttctcctatctttctcgttcacgttcattgagatatgttgagagaatgaatttgggc |
5941212 |
T |
|
| Q |
199 |
tcaatgatgatgca |
212 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5941211 |
tcaatgatgatgca |
5941198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University