View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5700-Insertion-8 (Length: 301)
Name: NF5700-Insertion-8
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5700-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 284
Target Start/End: Original strand, 393701 - 393992
Alignment:
| Q |
8 |
ttaccaatcccacattctaaggcgattgatatgggtgacaataggagcacacgggtgagatgaaggacactcgtttaaatgagctccagagctactgccg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
393701 |
ttaccaatcccacattctaaggcgattgatatgggtgacaataggagcacacgggtgagatgaaggacactcgtttaaatgagctccagatctactgccg |
393800 |
T |
|
| Q |
108 |
cgacgaaatcctttattccaagccacttgaagtattgtcaaaatcccccaatg----gc----aaa-------aggcgcccaaatttcaagagaatacgg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||| ||||||| ||| |
|
|
| T |
393801 |
tgacgaaatcctttattccaagccacttgaagtattgtcaaaatcccccaatgctttgccattaaaatcaagcaggcgcccaaatttcgagagaatccgg |
393900 |
T |
|
| Q |
193 |
ttcgccagctacccgaatcatcacgaattacttcaccacacacaacttaattatccttaagcattaaagctccatctgtattgcacttcatc |
284 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
393901 |
ttcgccagctacccgaatcattacgaattacttcaccacacacaacttaattatccttaagcattaaagctctatctgtattgcacttcatc |
393992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University