View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5700_high_4 (Length: 276)
Name: NF5700_high_4
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5700_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 11175791 - 11175543
Alignment:
| Q |
19 |
aggatttgtggaaccaacttgtctagtagttttcaaagtactctctttggccaattataatttcacatgagaagagaatcaaagtggtttgaaatcagaa |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11175791 |
aggatttgtggaaccaacttatctagtagttttcaaagtactctctttggccaattataatttcacatgagaagagaatcaaagtggtttgaaatcagaa |
11175692 |
T |
 |
| Q |
119 |
tttataatagtgataatatgtaatgtaaatactcttttatgttcttgtcaataaattttacaatctaatataccaaattttaatcaacatttactctaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11175691 |
tttataatagtgataatatgtaatgtaaatactcttttatgttcttgtcaataaattttacaatctaatataccaaattttaatcaacatttactctaac |
11175592 |
T |
 |
| Q |
219 |
tatctagattgttgtattgtcattgcctttaccattttaatttaatatct |
268 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11175591 |
tatctagattgttgtattgtcattgcc-ttaccattttaatttaatatct |
11175543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University