View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5700_low_6 (Length: 229)
Name: NF5700_low_6
Description: NF5700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5700_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 2 - 210
Target Start/End: Complemental strand, 10928251 - 10928041
Alignment:
| Q |
2 |
acactagtttcataatattattaggggatgttgggggaatctgtcagttgtacccaagcctctaggaagaagacaatatcatggacccaactttttaacg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
10928251 |
acactagtttcataatattattaggggatgttgggggaatctgtcagttgtacccaagcctctaggaaaaagacaatatcatggacccaactttttaatg |
10928152 |
T |
|
| Q |
102 |
tgccaaataatagggacagaacaattgcagatgcttctggatcatatatcagttcagagtatccattacaaaatctctagaat----catgctgctgcag |
197 |
Q |
| |
|
||||||||| ||| |||| ||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
10928151 |
tgccaaatagtagagacaaaacaaatgcagatgcttctggatcatatatc--ttcagagtatccgttacaaaatctctataatcatgcatgctgctgcag |
10928054 |
T |
|
| Q |
198 |
aacacgtaccttt |
210 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10928053 |
aacacgtaccttt |
10928041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University