View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5702-Insertion-1 (Length: 606)
Name: NF5702-Insertion-1
Description: NF5702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5702-Insertion-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 27 - 240
Target Start/End: Complemental strand, 47600282 - 47600088
Alignment:
| Q |
27 |
ctatggatttgtagataatagtaataatatggatttgatgttgctgaactcacttactattatctacgattcatccaatccacttacctctgttttggta |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47600282 |
ctatggatttgtagataatagtaataatatggatttgatgttgctgaactcacttactattatctacgattcatgcaatccacttacctct--------- |
47600192 |
T |
|
| Q |
127 |
acttctgtttatgttgctgaattaatgctgtggatttgatgcacagcctctgctttcgagggaccagaatgggtttgtggggttttctttcttcattcgt |
226 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47600191 |
------gtttatgttgctg----aatgctgtggatttgatgcacagactctgctttcgagggaccagaatgggtttgtggggttttctttcttcattcgt |
47600102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University