View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5702-Insertion-2 (Length: 417)
Name: NF5702-Insertion-2
Description: NF5702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5702-Insertion-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 8 - 357
Target Start/End: Original strand, 24224930 - 24225284
Alignment:
| Q |
8 |
atgtttgcttcgaaatggtaatttgcaacattccactaattggtattatttctttggatttttagattcacggtgtgcatattgtttggatggttttgag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224930 |
atgtttgcttcgaaatggtaatttgcaacattccactaattggtattatttctttggatttttagattcacggtgtgcatattgtttggatggttttgag |
24225029 |
T |
|
| Q |
108 |
cacgttttgaaattaattgcatcaatcatcaatattttggattttagagacgtagaagttattctttcaccgtggtatttacttg-----tttctttgat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
24225030 |
cacgttttgaaattaattgcatcaatcatcaatattttggattttagagacgtagaagttattctttcaccatggtatttacttgtttaatttctttgat |
24225129 |
T |
|
| Q |
203 |
gcttgtcgtcattggttaatgtttgttcggtttgctccggttgttggttgatatgtatagttttgtcgtgttttgggatgtgtatgggtgttcttttcgt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
24225130 |
gcttgtcgtcattggttaatgtttgttcggtctgctccggttgttggttgatatgtatagttttgtcatgttttgggatgtgtatgggtgttctttttgt |
24225229 |
T |
|
| Q |
303 |
ttgagtttttgtctttggatcgctcttgttcttggtttatttgtttgaggatgca |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24225230 |
ttgagtttttgtctttggatcgctcttgttcttggtttatttgtttgaggatgca |
24225284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University