View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5702-Insertion-3 (Length: 265)
Name: NF5702-Insertion-3
Description: NF5702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5702-Insertion-3 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
| [»] scaffold0004 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 265
Target Start/End: Original strand, 49349978 - 49350236
Alignment:
| Q |
8 |
ccctcaattacaacactttgagctgaggccatgggacatagattttccacttttactcactctttgatctaagttctttgatggcagtaggggatcattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49349978 |
ccctcaattacaacactttgagctgaggccatgggacataaattttccacttttactc----tttgatctaagttctttgatggcagtagaggatcattc |
49350073 |
T |
|
| Q |
108 |
tcagtatactgtatgtttattgatacacttcttctta-----attaataccttccttaacaagctcttcatatatatttatagatgtctctgccnnnnnn |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49350074 |
tcagtatactgtatgtttattgatacacttcttcttaattatattaataccttccttaacaagctcttcatatatatttatagatgtctctgccaaaaaa |
49350173 |
T |
|
| Q |
203 |
ntcagctcaaatttaagggagtgcatctttcttggacttgaagttacgccacaactcttcttc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49350174 |
atcagctcaaatttaagggagtgcatctttcttggacttgaagttacgccacaactcttcttc |
49350236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 49361897 - 49361998
Alignment:
| Q |
8 |
ccctcaattacaacactttgagctgaggccatgggacatagattttccacttttactcactctttgatctaagttctttgatggcagtaggggatcattc |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || ||||||||||||| |||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
49361897 |
ccctcaattacaacactttgagccgaggccatgggacgtaaattttccactttt----actccttgatctaagttcttcaatggcagtagaggatcattc |
49361992 |
T |
|
| Q |
108 |
tcagta |
113 |
Q |
| |
|
| |||| |
|
|
| T |
49361993 |
ttagta |
49361998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 265
Target Start/End: Original strand, 250292 - 250543
Alignment:
| Q |
8 |
ccctcaattacaacactttgagctgaggccatgggacatagattttccacttttactcactctttgatctaagttctttgatggcagtaggggatcattc |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
250292 |
ccctcaattgcaacactttgagctgaggccatgggacataaattttccacttttactc----tttgatctaagttctttgatggcagtagaggatcattc |
250387 |
T |
|
| Q |
108 |
tcagtatactgtatgtttattgatacacttcttcttaattaataccttccttaacaagctcttcatatatatttatagatgtctctgccnnnnnnntcag |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
250388 |
tcagtatactgtatgtttattgataca---cttcttaattaataccttccttaacaagctcttcatatatatttatagatgtctctgccaaaaaaatcag |
250484 |
T |
|
| Q |
208 |
ctc-aaatttaagggagtgcatctttcttggacttgaagttacgccacaactcttcttc |
265 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250485 |
ctcaaaatttaagggagtgcatctttcttggacttgaagttacgccacaactcttcttc |
250543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University