View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5702_low_6 (Length: 274)
Name: NF5702_low_6
Description: NF5702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5702_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 39 - 259
Target Start/End: Original strand, 7546448 - 7546665
Alignment:
| Q |
39 |
atgtagattccactactttgatgataaatttcaaaatgaagagatatcaggaagtattgtgccaaaacaaaatttgagaaatttcaaatgcaagctaata |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7546448 |
atgtagattccactactttgatgataaatttcaaaatgaagagatatcatgaagtattgtgccaaaacaaaatttgagaaatttcaaatgcaatataata |
7546547 |
T |
|
| Q |
139 |
ggtaagaacttgaacttctcttttggtgtaagtgcttatttatagatgagagcataagttgaaaacttgttgtgggactccctgcatgatttatttgtca |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7546548 |
ggtaagaacttgaacttctctcttggtgtaagtgcttatttatagatgagagcataagttgaaaa---tttgtgggactccctgcatgatttatttgtca |
7546644 |
T |
|
| Q |
239 |
tcgtctgatatcattcatgtg |
259 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7546645 |
tcgtctgatatcattcatgtg |
7546665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University