View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5704-Insertion-7 (Length: 134)
Name: NF5704-Insertion-7
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5704-Insertion-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 4867637 - 4867511
Alignment:
| Q |
8 |
atggtaggaatgggttggataatattattgtagatttcaggccgttggcaaaaaagattattctcattgacacctaaggactcagattaaggcccttgag |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
4867637 |
atggtaggaatgggttggataatcttattgtagatttcaggccgttggcaaaaaagattattctcattgacacctaaggactcagatgaaggcccgtgag |
4867538 |
T |
|
| Q |
108 |
tggtcgcattggttggagtcccaaaag |
134 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
4867537 |
tggtcgcattggttggagttccaaaag |
4867511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 3e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 7159489 - 7159374
Alignment:
| Q |
11 |
gtaggaatgggttggataatattattgtagatttcaggccgttggcaaaaaagattattctcattgacacctaaggactcagattaaggcccttgagtgg |
110 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| ||| || ||||| |||| ||||||| || ||| |||||||||||| |||| || |||||||||||| |
|
|
| T |
7159489 |
gtaggaatgggttggatagtattattgtatattgcagtcccttggctaaaaggattattttctttgtcacctaaggactgagatgaatgcccttgagtgg |
7159390 |
T |
|
| Q |
111 |
tcgcattggttggagt |
126 |
Q |
| |
|
|| ||| |||| |||| |
|
|
| T |
7159389 |
tcacatcggtttgagt |
7159374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University