View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5704_high_23 (Length: 205)
Name: NF5704_high_23
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5704_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 41249952 - 41250128
Alignment:
| Q |
1 |
tcatcacaatatcacatccagccagctgaaaataaagtaccaaatctgtgctgataactaccagtggcagaataaataaataccagtctcataaaattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249952 |
tcatcacaatatcacatccagccagctgaaaataaagtaccaaatctgtgctgataactaccagtggcagaataaataaataccagtctcataaaattca |
41250051 |
T |
|
| Q |
101 |
tctcaaataatacaaaacatttgatcatgtctttccaatgtctttaatttcttctcttcagaactaactaactaactaacggatatt |
187 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41250052 |
tct---------caaaacatttgatcatgtctttcc-atgtctttaatttcttctcttcagaactaactaactaactaacggatatt |
41250128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University