View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5704_low_16 (Length: 255)

Name: NF5704_low_16
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5704_low_16
NF5704_low_16
[»] chr4 (1 HSPs)
chr4 (9-239)||(43503466-43503696)
[»] chr3 (1 HSPs)
chr3 (45-231)||(34564358-34564544)


Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 43503696 - 43503466
Alignment:
9 gagatgaagtcactgcgctatctagatgcgcactttaatgaactacatgggcttcctattgcaatcgggaaattgactagtcttgaatttctaaacctga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43503696 gagatgaagtcactgcgctatctagatgcgcactttaatgaactacatgggcttcctattgcaatcgggaaattgactagtcttgaatttctaaacctga 43503597  T
109 gtagtaacttcagcgatcttcaagaaataccagagacatttggtgatctgagtagcctcaaggaattggatcttagcaacaatcaaattcatgcacttcc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
43503596 gtagtaacttcagcgatcttcaagaaataccagagacatttggtgatttgagtagcctcaaggaattggatcttagcaacaatcaaattcatgcacttcc 43503497  T
209 tgatacatttggccgccttgatagtttaatc 239  Q
    |||||||||||||||||||||||||||||||    
43503496 tgatacatttggccgccttgatagtttaatc 43503466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 45 - 231
Target Start/End: Complemental strand, 34564544 - 34564358
Alignment:
45 aatgaactacatgggcttcctattgcaatcgggaaattgactagtcttgaatttctaaacctgagtagtaacttcagcgatcttcaagaaataccagaga 144  Q
    ||||| ||||||||||||||    ||| | |||| | |||||| ||| ||| |||| ||| |||| ||||| |||   |||||| ||||| | |||||||    
34564544 aatgagctacatgggcttccagcagcatttgggagactgactactctggaaattctcaacttgagcagtaatttcgctgatcttaaagaacttccagaga 34564445  T
145 catttggtgatctgagtagcctcaaggaattggatcttagcaacaatcaaattcatgcacttcctgatacatttggccgccttgata 231  Q
    ||||||| ||  ||| ||  ||||||||||||||| | || || ||||| |||||||||||||| |||||||||||  |||||||||    
34564444 catttggcgaattgactaatctcaaggaattggatgtcagtaataatcagattcatgcacttccagatacatttggttgccttgata 34564358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University