View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5704_low_21 (Length: 236)
Name: NF5704_low_21
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5704_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 7028425 - 7028631
Alignment:
| Q |
15 |
agcataggtttgtttctttatctcactctcttgcttattttaaaaccgaggggtgtagttccaaatccaatttcaaacaagatattttctccttctactt |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028425 |
agcataagtttgtttctttatctcactctcttgcttattttaaaaccgaggggtgtagttccaaatccaatttcaaacaagatattttctccttctactt |
7028524 |
T |
 |
| Q |
115 |
ctatccctgcacctcagataaaatatgatgtctttgttagctttagaggtagtgacattcgcaaaaatttccttagccatgtcctcgacgctttgtcgcg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028525 |
ctatccctgcacctcagataaaatatgatgtctttgttagctttagaggtagtgacattcgcaaaaatttccttagccatgtcctcgacgctttgtcgcg |
7028624 |
T |
 |
| Q |
215 |
aaaggga |
221 |
Q |
| |
|
||||||| |
|
|
| T |
7028625 |
aaaggga |
7028631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 218
Target Start/End: Complemental strand, 7078722 - 7078600
Alignment:
| Q |
96 |
atattttctccttctacttctatccctgcacctcagataaaatatgatgtctttgttagctttagaggtagtgacattcgcaaaaatttccttagccatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
7078722 |
atattttctccttctacttctatccctgctcctcagataaaatatgatgtctttgttagctttagaggcagtgacattcgcaaacacttccttagccatg |
7078623 |
T |
 |
| Q |
196 |
tcctcgacgctttgtcgcgaaag |
218 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
7078622 |
tcctcgaagctttgtcgcgaaag |
7078600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 95 - 218
Target Start/End: Original strand, 7035207 - 7035330
Alignment:
| Q |
95 |
gatattttctccttctacttctatccctgcacctcagataaaatatgatgtctttgttagctttagaggtagtgacattcgcaaaaatttccttagccat |
194 |
Q |
| |
|
||||||||||||| ||| ||| | ||||| |||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||| |
|
|
| T |
7035207 |
gatattttctcctactagttccagccctgttcctcagataaaatatgatgtctttgttagcttcaggggtagtgatattcgcaaaaatttccttagccat |
7035306 |
T |
 |
| Q |
195 |
gtcctcgacgctttgtcgcgaaag |
218 |
Q |
| |
|
|| || || ||||| ||||||||| |
|
|
| T |
7035307 |
gttcttgaggctttttcgcgaaag |
7035330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University