View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5705_low_10 (Length: 339)
Name: NF5705_low_10
Description: NF5705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5705_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 9 - 322
Target Start/End: Original strand, 1602229 - 1602542
Alignment:
| Q |
9 |
gattatactaacagttcataaccgtccgtgaattcttattgttaggttaacacttatagttgacttgttaagagccatgagtctagagtgatcccacgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1602229 |
gattatactaacagttcataaccgtccgtgaattcttattgttaggttaacacttatagttgacttgttaagagccatgagtctagagtgatcccacgat |
1602328 |
T |
 |
| Q |
109 |
ctctattaaccagtgtgatcttcgaaaacttacgtgcaaaaataatttgtcaaagggtttagataaatctgctactaccttttcggtccaaaaaatacaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1602329 |
ctctattaaccagtgtgatcttcgaaaacttacgtgcaaaaataatttgtcaaagggtttagataaatctgctactaccttttcggtccaaaaaatacaa |
1602428 |
T |
 |
| Q |
209 |
agctgtcactgctgttgaaattttaggtatctctagattatgaaatatgattcaaaactttcccgttttaagtttcataagctgtacaaactttttatcg |
308 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1602429 |
agctgtcactactgttgaaattttaggtatctctagattatgaaatatgattcaaaactttcccgttttaagtttcataagctgtacaaactttttatcg |
1602528 |
T |
 |
| Q |
309 |
ttgtgataaagtag |
322 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
1602529 |
ttgtgctaaagtag |
1602542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University