View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5705_low_9 (Length: 367)
Name: NF5705_low_9
Description: NF5705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5705_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 36 - 333
Target Start/End: Complemental strand, 36372674 - 36372364
Alignment:
| Q |
36 |
gaaagaaaatattatgtattgtaagaggatcatttaacactcacatagcagtttttgaagatggtaattat-----ggtacgttgagaatctagattttg |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36372674 |
gaaagaaaatattatgtattgtaagaggatcatttaacactcacatagcagtttttgaagatggtaattattttatggtacgttgagaatctagattttg |
36372575 |
T |
 |
| Q |
131 |
taggtagtagtagta---cgacgaacttgtctttcattttgggcatgtgctctgct-----ttgtgtctttttaattgtacttatgnnnnnnncctttta |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
36372574 |
taggtagtagtagtagtacgacgaacttgtctttcattttgggcatgtgctctgctctgctttgtgtctttttaattgtacttgtgtttttttcctttta |
36372475 |
T |
 |
| Q |
223 |
aagtcggtttacttttaaattcagtgacggaactgcccttgtttcaagagccgccttcttctgtatcacaattcacaagggtataattgggaaaacttaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36372474 |
aagtcggtttacttttaaattcagtgacggaactgcccttgtttcaagagccgccttcttctatatcacaattcacaagggtataactgggaaaacttaa |
36372375 |
T |
 |
| Q |
323 |
ttgttggatca |
333 |
Q |
| |
|
||||||||||| |
|
|
| T |
36372374 |
ttgttggatca |
36372364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University