View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706-Insertion-8 (Length: 167)
Name: NF5706-Insertion-8
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706-Insertion-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 6 - 167
Target Start/End: Complemental strand, 41468301 - 41468140
Alignment:
| Q |
6 |
cacaagacagaaccaggaacaggaacagcaacagcaccaggtgcaagaccaagaattcttgtatatcttccaacaaaccaagtcattcattccttctctc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468301 |
cacaagacagaaccaggaacaggaacagcaacagcaccaggtgcaagaccaagagttcttgtatatcttccaacaaaccaagtcattcattccttctctc |
41468202 |
T |
 |
| Q |
106 |
aacttgagcaacgactcactgaacttggttggactcgttactctcactctcatcttccagac |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468201 |
aacttgagcaacgactcactgaacttggttggactcgttactctcactctcatcttccagac |
41468140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University