View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_25 (Length: 358)
Name: NF5706_high_25
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 351
Target Start/End: Original strand, 2244960 - 2245294
Alignment:
| Q |
16 |
ataaatcttacctataataacggttgcttggggagatgatgtaacgccggagctcttgtctcttgctgccatacatggtggcggcaccgagagatggaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2244960 |
ataaatcttacctataataacggttgcttggggagatgatgtaacgccggagctcttgtctcttgctgccatacatggtggcggcaccgagagatggaat |
2245059 |
T |
|
| Q |
116 |
gaatccggtaagactgtattggctgctagaatcatctttggtttgtttttgtttatcatttttacgaccaaaggactttattccaaacatcttcatgatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2245060 |
gaatccggtaagactgtattggctgctagaatcatctttggtttgtttttgtttatcatttttacgaccaaaagactttattccaaacatcttcatgatc |
2245159 |
T |
|
| Q |
216 |
ttcctcgtaaaggggatcaaggagagacacactatgcattcatgtgttattttcttctcataattttgttcatgattttatttggtggcattcttgtttt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
2245160 |
ttcctcgtaaaggggatcaaggagagacacactatgcattcatgtgttattttcttctcataattttgttcatgattttatttggtggcattc-tggttt |
2245258 |
T |
|
| Q |
316 |
gtatattggtttgttagcaagaatgaagaataatgt |
351 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2245259 |
gtatatcggtttgttagcaagaatgaagaataatgt |
2245294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University